An example of a valid input sequence

> Test sequence
CCCCTCAGTGACCACTTATTTCTTTTGTTGTCAGCCTTTCCCTATTTTCTTTTCTTTTCTTTTCTTTTTTTTAAGACAAGGTGTTGC
TGTGTCACCCAAGCTGGAGTACAGTGGTGGTAATCACGGCAGCCTCTAACTCCTGGACTCAAGTGATCCTCCTGCCTTGGCCTCCCG
AGTAGCTGGGACTCTGCAGATATGCACCACCACATGCCCCGCTAATTTATTTTTAGTATTTTAGAAGCAGTGTTTTGCTGTCTTGCC
CAGGCTCGGCTTGAACTCCTGGCGTCAAGCTATCCCACCTCCCAAAGTGCTGGGATTATAGGCAGGAGTGCCCAGCCCCAGAGTTCT
TACAATGACTTACAAGGTCTTACGTGATCTTGTTGCCTCCCTTTTGCTCTCTGACCTCATCTTTTTTTTTTTTTTTGAGATGGAGTC
TCACTCTGCCACCCAGGCTGGAGTACAGTGGCTCACTGCAGTCTTCACCTCCCAGGTTCAAGTGATTATCCTGCCTCAGCCTCCCGA
GTTAGCTGGGAATACAGGCACGTGTCACCAGGCCCGGCTAATTTTTGCATTTTTTTTTTCAGTAGAGATGAGGTTTCACCAGGTTGG
CCAGTCTGGTCTGGAACTCCTGGCCTCACATGATCCGCCTGCCTCGGCCTCCCAAAGTGATGAGATTACAGGCGTGAGCCACCGCGC
CCGGCCTAGTCACTTTTTTCTTAATTGCAACCCCGATTCTCAGCACCCTTTTCATCTTGGTTTTCCTCAATAGCCCTTACCACCAGC
AGACACACATCATCTGTTGTACTTGCTTATTTGGCACATATGTATCCACAGCGCCTAGAACACTGCCTGTAACGTGGAAGGTGTTCG
ATCTATAGAGTTTTGTCGAATGAATGAATGAAGCCGACTAGTGCACAGGGAGTGCAGCGGCGCGATGGTAGCTCTCTGCAGCCTCCA
ACACCTGGGCTCCAGTGATCCCCGGGCTCTGCCCACCCTCCCCACTGCCACTTCCGGGCAGAGGCCAGCAAAGCGGC