Nucleosome eXclusion Sensor

Understanding the output

NXSensor output will be displayed in a separate window. You can then copy it to your word processor (e.g. Microsoft Word) for further formatting.

NXSensor can produce two different versions of the output depending on which option is selected:

1. If the option “Exclusion sequences” is selected, nucleosome-exclusion sequences will be highlighted in red to provide visual information about their clustering in the input sequence.

2. Otherwise, if the option “Nucleosome segments” is selected, NXSensor will highlight the segments of the input DNA sequence where nucleosomes are likely to be, and compute sequence accessibility.

Nucleosome segments

Parameter NXmin specifies the minimal number of exclusion sequences per window that is deemed sufficient to prevent nucleosome formation. Default value is NXmin = 1. Windows with less than NXmin exclusion sequences allow nucleosome formation and will be highlighted in dark gray. We refer to these as “nucleosome segments.” Other segments are nucleosome-free and will be left without highlight. We refer to these as “open segments.” The convention used in highlighting is that a nucleosome cannot cover any part of the exclusion sequence.

Ends of the input DNA sequences are treated conservatively. For example, if the spacing between the start of the DNA sequence and the first exclusion sequence is greater than 0 and less than window length (default 147), we do not know whether that segment will be open or not, because we do not know which nucleotides are there in the genome before the start of the input sequence. Such ambiguous segments are highlighted in light gray.

Accessibility

Accessibility is a measure of how accessible a particular DNA sequence might be to DNA-binding proteins, given that portions of it may be bound to nucleosomes. As a first approximation, and neglecting the cases in which proteins may bind nucleosomal DNA or displace DNA-bound histones, we assume that each DNA-binding protein needs an open DNA segment of certain length to be able to dock. The user can set the minimum length of this open segment - OSmin. The default is OSmin = 10 bp, which is the estimate of the minimum length of a DNA segment needed for most DNA-binding proteins to dock. Accessibility is the fraction of the DNA sequence contained in open segments that are at least OSmin bp long. NXSensor computes accessibility for each input sequence in the following way:

total length of open contiguous segments >= OSmin

Accessibility(OSmin) = ----------------------------------------------------------------

(length of input sequence) – (total length of ambiguous segments)

If the entire input sequence is ambiguous, which may happen if it is short, accessibility cannot be computed. NXSensor will indicate this situation by shading the entire sequence in light gray and displaying “NaN” (Not a Number) symbol for accessibility.

Example

With the following input sequence in FASTA format

> Test sequence

CCCCTCAGTGACCACTTATTTCTTTTGTTGTCAGCCTTTCCCTATTTTCTTTTCTTTTCTTTTCTTTTTTTTAAGACAAGGTGTTGC

TGTGTCACCCAAGCTGGAGTACAGTGGTGGTAATCACGGCAGCCTCTAACTCCTGGACTCAAGTGATCCTCCTGCCTTGGCCTCCCG

AGTAGCTGGGACTCTGCAGATATGCACCACCACATGCCCCGCTAATTTATTTTTAGTATTTTAGAAGCAGTGTTTTGCTGTCTTGCC

CAGGCTCGGCTTGAACTCCTGGCGTCAAGCTATCCCACCTCCCAAAGTGCTGGGATTATAGGCAGGAGTGCCCAGCCCCAGAGTTCT

TACAATGACTTACAAGGTCTTACGTGATCTTGTTGCCTCCCTTTTGCTCTCTGACCTCATCTTTTTTTTTTTTTTTGAGATGGAGTC

TCACTCTGCCACCCAGGCTGGAGTACAGTGGCTCACTGCAGTCTTCACCTCCCAGGTTCAAGTGATTATCCTGCCTCAGCCTCCCGA

GTTAGCTGGGAATACAGGCACGTGTCACCAGGCCCGGCTAATTTTTGCATTTTTTTTTTCAGTAGAGATGAGGTTTCACCAGGTTGG

CCAGTCTGGTCTGGAACTCCTGGCCTCACATGATCCGCCTGCCTCGGCCTCCCAAAGTGATGAGATTACAGGCGTGAGCCACCGCGC

CCGGCCTAGTCACTTTTTTCTTAATTGCAACCCCGATTCTCAGCACCCTTTTCATCTTGGTTTTCCTCAATAGCCCTTACCACCAGC

AGACACACATCATCTGTTGTACTTGCTTATTTGGCACATATGTATCCACAGCGCCTAGAACACTGCCTGTAACGTGGAAGGTGTTCG

ATCTATAGAGTTTTGTCGAATGAATGAATGAAGCCGACTAGTGCACAGGGAGTGCAGCGGCGCGATGGTAGCTCTCTGCAGCCTCCA

ACACCTGGGCTCCAGTGATCCCCGGGCTCTGCCCACCCTCCCCACTGCCACTTCCGGGCAGAGGCCAGCAAAGCGGC

And with “Nucleosome segments” option selected, the following output is obtained

Accessibility(10):

0.4050 > Test sequence

7 nucleosome exclusion sequences found